ZFIN ID: ZDB-MRPHLNO-080324-5
Morpholino Name: MO1-pcna
Target: pcna (1)
Sequence:
5' - TGAACCAGACGTGCCTCAAACATTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-pcna No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-pcna No data available
PHENOTYPE
Phenotype resulting from MO1-pcna
No data available

Phenotype of all Fish created by or utilizing MO1-pcna
Genome Resources:
CITATIONS (4)