header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080213-3
Morpholino Name: MO1-tfap2c
Target: tfap2c (1)
Sequence:
5' - TTGGGCAGAGACACCGGACCTGGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice blocking morpholino designed against the intron 4- exon 5 boundary.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-tfap2c No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-tfap2c
Expressed Gene Anatomy Figures
cki Fig. 6 from Hoffman et al., 2007
dlx2a Fig. 4 from Hoffman et al., 2007
foxd3 Fig. 4 from Hoffman et al., 2007
krt18a.1 Fig. 6 from Hoffman et al., 2007
PHENOTYPE
Phenotype resulting from MO1-tfap2c
No data available

Phenotype of all Fish created by or utilizing MO1-tfap2c
Genome Resources:
CITATIONS (3)