header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-080110-2
Morpholino Name: MO2-foxh1
Target: foxh1 (1)
Sequence:
5' - GGAGGTGGAAGGTATGGTCGCTCCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-foxh1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-foxh1 No data available
PHENOTYPE
Phenotype resulting from MO2-foxh1
Phenotype of all Fish created by or utilizing MO2-foxh1
OTHER MO2-foxh1 MORPHOLINO PAGES No links to external sites
CITATIONS (1)