Morpholino

MO1-st14a

ID
ZDB-MRPHLNO-071218-1
Name
MO1-st14a
Previous Names
None
Target
Sequence
5' - AACGCATTCCTCCATCCATAGGGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-st14a
Expressed Gene Anatomy Figures
lcp1 Fig. 7 with image from Carney et al., 2007
Phenotype
Phenotype resulting from MO1-st14a
No data available
Phenotype of all Fish created by or utilizing MO1-st14a
Phenotype Fish Conditions Figures
caudal fin epidermal cell aggregated, ameliorated spint1afr26/fr26 + MO1-st14a control Fig. 1 from Armistead et al., 2020
integument cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 2 with image from Schepis et al., 2018
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a control Fig. 5 from Armistead et al., 2020
whole organism il1b expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp9 expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp13a expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epithelial cell protruding out of epidermal superficial stratum, ameliorated cy22Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 3 with image from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated la213Tg; mu271Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated la213Tg; mu271Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal superficial stratum cell population proliferation increased occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
Citations