ZFIN ID: ZDB-MRPHLNO-070521-1
Morpholino Name: MO5-atoh1a
Target: atoh1a (1)
Sequence:
5' - GTATCCGTGCTCATTCCATCCATTC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This morpholino was designed against the translation initiation codon.
TARGET LOCATIONS
View all 3 target locations
No data available
CONSTRUCTS WITH SEQUENCES FROM MO5-atoh1a No data available
GENE EXPRESSION
Gene expression in Wild Types + MO5-atoh1a
Expressed Gene Anatomy Figures
alcama Fig. 1 with image from Sassa et al., 2007
atoh1b Fig. 1 with image from Sassa et al., 2007
PHENOTYPE
Phenotype resulting from MO5-atoh1a
No data available

Phenotype of all Fish created by or utilizing MO5-atoh1a
No data available
Genome Resources:
CITATIONS (1)