Morpholino

MO2-atoh1a

ID
ZDB-MRPHLNO-070507-2
Name
MO2-atoh1a
Previous Names
  • atoh1a MO1 (1)
Target
Sequence
5' - TCTGTTGGTTTGTGCTTTTGGGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
View all 3 target locations
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-atoh1a
Phenotype
Phenotype resulting from MO2-atoh1a
Phenotype of all Fish created by or utilizing MO2-atoh1a
Citations