ZFIN ID: ZDB-MRPHLNO-060626-8
Morpholino Name: MO1-atp1b2b
Target: atp1b2b (1)
Sequence:
5' - TTTCCTGGACTAAATGTGCGCTCAC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-atp1b2b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-atp1b2b No data available
PHENOTYPE
Phenotype resulting from MO1-atp1b2b
No data available

Phenotype of all Fish created by or utilizing MO1-atp1b2b
No data available
Genome Resources:
CITATIONS (1)