ZFIN ID: ZDB-MRPHLNO-060623-1
Morpholino Name: MO1-fgf21
Target: fgf21 (1)
Sequence:
5' - GGCAAAAAGCATGACTGACTAAGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: The sequence corresponds to the 5' non-coding region of fgf21.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-fgf21 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-fgf21
Expressed Gene Anatomy Figures
gata1a Fig. 7Fig. 8 from Ceinos et al., 2013
Fig. 4 from Yamauchi et al., 2006
gata2a Fig. 4 from Yamauchi et al., 2006
hbbe3 Fig. 7Fig. 9 from Ceinos et al., 2013
kdrl Fig. 2 from Yamauchi et al., 2006
lcp1 Fig. 4 from Yamauchi et al., 2006
mpx Fig. 4 from Yamauchi et al., 2006
rag1 Fig. 4 from Yamauchi et al., 2006
sparc Fig. 7 from Ceinos et al., 2013
spi1b Fig. 4 from Yamauchi et al., 2006
tal1 Fig. 4 from Yamauchi et al., 2006
PHENOTYPE
Phenotype resulting from MO1-fgf21
Phenotype Figures
erythroid lineage cell hbbe3 expression decreased amount, abnormal Fig. 9 from Ceinos et al., 2013
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal Fig. 8 from Ceinos et al., 2013
notochord sparc expression decreased amount, abnormal Fig. 7 from Ceinos et al., 2013
otic vesicle sparc expression decreased amount, abnormal Fig. 7 from Ceinos et al., 2013
whole organism gata1a expression decreased amount, abnormal Fig. 7 from Ceinos et al., 2013
whole organism hbbe3 expression decreased amount, abnormal Fig. 7 from Ceinos et al., 2013

Phenotype of all Fish created by or utilizing MO1-fgf21
Phenotype Fish Conditions Figures
notochord sparc expression decreased amount, abnormal AB + MO1-fgf21 control Fig. 7 from Ceinos et al., 2013
intermediate cell mass of mesoderm gata1a expression decreased amount, abnormal AB + MO1-fgf21 control Fig. 8 from Ceinos et al., 2013
otic vesicle sparc expression decreased amount, abnormal AB + MO1-fgf21 control Fig. 7 from Ceinos et al., 2013
whole organism gata1a expression decreased amount, abnormal AB + MO1-fgf21 control Fig. 7 from Ceinos et al., 2013
whole organism hbbe3 expression decreased amount, abnormal AB + MO1-fgf21 control Fig. 7 from Ceinos et al., 2013
erythroid lineage cell hbbe3 expression decreased amount, abnormal AB + MO1-fgf21 control Fig. 9 from Ceinos et al., 2013
OTHER MO1-fgf21 MORPHOLINO PAGESNo links to external sites
CITATIONS (2)