header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050926-2
Morpholino Name: MO2-dhrs9
Target: dhrs9 (1)
Previous Names: MO2-rdh1l, rdh1l ATG-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - TATATTGTCAGCTTTCAGAGTGGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: Translation blocking morpholino.
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO2-dhrs9 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO2-dhrs9
Expressed Gene Anatomy Figures
fabp2 Fig. 3 from Nadauld et al., 2005
gata6 Fig. 4 from Nadauld et al., 2005
prss1 Fig. 3 from Nadauld et al., 2005
PHENOTYPE
Phenotype resulting from MO2-dhrs9
Phenotype of all Fish created by or utilizing MO2-dhrs9
Phenotype Fish Conditions Figures
whole organism decreased size, abnormal AB + MO2-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
heart looping arrested, abnormal AB + MO2-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
post-vent region curved ventral, abnormal AB + MO2-dhrs9 standard conditions Fig. 1 from Wang et al., 2013
pectoral fin development disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
pericardium edematous, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
intestine molecular quality, abnormal WT + MO2-dhrs9 standard conditions Fig. 3 from Nadauld et al., 2005
intestine morphology, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
pancreas molecular quality, abnormal WT + MO2-dhrs9 standard conditions Fig. 3 from Nadauld et al., 2005
intestine lacks all parts of type columnar/cuboidal epithelial cell, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
mandibular arch skeleton absent, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
intestinal bulb hypoplastic, abnormal WT + MO2-dhrs9 standard conditions Fig. 4text only from Nadauld et al., 2005
pectoral fin absent, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
intestine lacks all parts of type intestinal villus, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
pancreas development disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 3 from Nadauld et al., 2005
digestive tract development disrupted, abnormal WT + MO2-dhrs9 standard conditions Fig. 3Fig. 4text only from Nadauld et al., 2005
intestinal epithelium aplastic, abnormal WT + MO2-dhrs9 standard conditions Fig. 4 from Nadauld et al., 2005
eye decreased size, abnormal WT + MO2-dhrs9 standard conditions Fig. 2 from Nadauld et al., 2005
Genome Resources:
CITATIONS (2)