ZFIN ID: ZDB-MRPHLNO-050923-3
Morpholino Name: MO1-junbb
Target: junbb (1)
Previous Names: b-jun MO (1), MO1-junbl

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - ACTCATAGAGTTGGAAAACCGGTGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a translation blocking morpholino targeting the gene junbl.
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-junbb No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-junbb No data available
PHENOTYPE
Phenotype resulting from MO1-junbb
No data available

Phenotype of all Fish created by or utilizing MO1-junbb
No data available
Genome Resources:
CITATIONS (1)