header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MRPHLNO-050825-2
Morpholino Name: MO1-hoxb1b
Target: hoxb1b (1)
Sequence:
5' - AATTCATTGTTGACTGACCAAGCAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-hoxb1b No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-hoxb1b No data available
PHENOTYPE
Phenotype resulting from MO1-hoxb1b
No data available

Phenotype of all Fish created by or utilizing MO1-hoxb1b
Phenotype Fish Conditions Figures
rhombomere 4 tshz3b expression absent, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 tshz3b expression decreased amount, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
trunk axis tshz3b expression decreased amount, abnormal AB + MO1-hoxb1a + MO1-hoxb1b control Fig. 2 from Erickson et al., 2011
presumptive rhombomere 4 znf703 expression decreased amount, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 2 with image from Labalette et al., 2015
presumptive rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 znf703 expression decreased amount, abnormal WT + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 2 with image from Labalette et al., 2015
rhombomere 4 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 2 egr2b expression mislocalised, abnormal WT + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 4 egr2b expression mislocalised, abnormal egr2bfh227/fh227 + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
presumptive rhombomere 3 egr2b expression increased distribution, abnormal egr2bfh227/fh227 + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 1 with image from Labalette et al., 2015
rhombomere 4 Citrine expression increased distribution, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
rhombomere 4 egr2b expression mislocalised, abnormal fci3Tg/fci3Tg + MO1-epha4a + MO1-hoxb1a + MO1-hoxb1b + MO4-tp53 standard conditions Fig. 6 with image from Addison et al., 2018
presumptive rhombomere 4 GFP expression decreased amount, abnormal zf1077Tg + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 4 with image from Labalette et al., 2015
presumptive rhombomere 3 GFP expression decreased amount, abnormal zf1077Tg + MO1-hoxb1a + MO1-hoxb1b standard conditions Fig. 4 with image from Labalette et al., 2015
Genome Resources:
CITATIONS (8)