ZFIN ID: ZDB-MRPHLNO-050201-2
Morpholino Name: MO1-unc119.1
Target: unc119.1 (1)
Previous Name: unc119-MO (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - AGCTCTGACTGTTCATCTCTCGGAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-unc119.1 No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-unc119.1 No data available
PHENOTYPE
Phenotype resulting from MO1-unc119.1
Phenotype Figures
Kupffer's vesicle morphology, abnormal Fig. 6 from Wright et al., 2011
visual perception disrupted, abnormal Fig. 6 from Wright et al., 2011
whole organism curved ventral, abnormal Fig. 6 from Wright et al., 2011

Phenotype of all Fish created by or utilizing MO1-unc119.1
Phenotype Fish Conditions Figures
whole organism curved ventral, abnormal WT + MO1-unc119.1 standard conditions Fig. 6 from Wright et al., 2011
visual perception disrupted, abnormal WT + MO1-unc119.1 standard conditions Fig. 6 from Wright et al., 2011
Kupffer's vesicle morphology, abnormal WT + MO1-unc119.1 standard conditions Fig. 6 from Wright et al., 2011
OTHER MO1-unc119.1 MORPHOLINO PAGESNo links to external sites
CITATIONS (3)