ZFIN ID: ZDB-MRPHLNO-041203-1
Morpholino Name: MO1-dld
Target: dld (1)
Previous Names: MO-e11/i11-dld (1), MO[dlD-V] (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Sequence:
5' - GGTTTTGGACTTACCTCGGTTGCAA - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
Note: This is a splice-blocking morpholino designed to remove the valine residue of the 'ATEV' sequence of delta D. 'ATEV' is thought to confer binding of deltaD to a PDZ-domain in MAGI proteins like magi1 (baiap1).
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM MO1-dld No data available
GENE EXPRESSION
Gene expression in Wild Types + MO1-dld
Expressed Gene Anatomy Figures
clu Fig. 6 from Jiao et al., 2011
PHENOTYPE
Phenotype resulting from MO1-dld
Phenotype Figures
choroid plexus clu expression increased distribution, abnormal Fig. 6 from Jiao et al., 2011

Phenotype of all Fish created by or utilizing MO1-dld
Phenotype Fish Conditions Figures
choroid plexus clu expression increased distribution, abnormal WT + MO1-dld standard conditions Fig. 6 from Jiao et al., 2011
choroid plexus fourth ventricle increased size, abnormal mn16Et + MO1-dla + MO1-dld standard conditions Fig. 5 with image from Bill et al., 2008
OTHER MO1-dld MORPHOLINO PAGESNo links to external sites
CITATIONS (4)