header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-MIRNAG-090112-2
miRNA Gene Name: microRNA 126a
miRNA Gene Symbol: mir126a    Nomenclature History

{{control.fieldName}} Edit

ID: {{control.nomenID}}
{{control.fieldName}}:
Reason:
Comments:

Attributions

{{pub.zdbID}}
Previous Names: miR-126 (1), miR126 (1), mir126

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
miRNA Gene Type: miRNA_gene
Location: Chr: 8 Mapping Details/Browsers
Description: Involved in several processes, including circulatory system development; gene silencing by miRNA; and regulation of signal transduction. Is expressed in cardiovascular system. Orthologous to human MIR126 (microRNA 126).
Genome Resources: Alliance (1)
Note: full hairpin sequence from miRBase >dre-mir-126 MI0001979 GAGCCAUUUUAACUGCUUCACAGUCCAUUAUUACUUUUGGUACGCGCUAGGCCAGACUCAAACUCGUACCGUGAGUAAUAAUGCACUGUGGCAGUGGGUUU
MUTATIONS AND SEQUENCE TARGETING REAGENTS
Allele Type Localization Consequence Mutagen Suppliers
bns2 Small Deletion Unknown Unknown TALEN
sih1 Small Deletion Unknown Unknown CRISPR
sih2 Small Deletion Unknown Unknown CRISPR
DISEASE ASSOCIATED WITH mir126a HUMAN ORTHOLOG No data available
DISEASE ASSOCIATED WITH mir126a VIA EXPERIMENTAL MODELS No data available
GENE ONTOLOGY
Ontology GO Term
Biological Process gene silencing by miRNA (more)
GO Terms (all 10)
TRANSCRIPTS
Type Name Length (nt) Analysis
miRNA mir126-001 (1) 21
mir126*-002 (1) 21
INTERACTIONS AND PATHWAYS
ANTIBODIES No data available
PLASMIDS No data available
CONSTRUCTS WITH SEQUENCES FROM mir126a No data available
MARKER RELATIONSHIPS
mir126a Contained in: [BAC] CH211-248E11 (1) (order this)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA miRBASE Stem Loop:MI0001979 (1) 101 bp
Genomic GenBank:CR361566 (1) 182625 bp
Select Tool
ORTHOLOGY for mir126a ( Chr: 8 )
CITATIONS (31)