ZFIN ID: ZDB-MIRNAG-070112-1
miRNA Gene Name: microRNA 10c
miRNA Gene Symbol: mir10c
Sequence Ontology ID : SO:0001265

{{control.fieldName}} Edit

ID: {{control.nomenID}}
{{control.fieldName}}:
Reason:
Comments:

Attributions

{{pub.zdbID}}
Previous Names: dre-mir-10c, miR-10c (1), miR10c (1), mirn10c (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Location: Chr: 3 Mapping Details/Browsers
Nomenclature History
Note: Hairpin Sequence from miRBase: CCUGUCAUCUAUAUAUACCCUGUAGAUCCGGAUUUGUGUAAACAGACGCACAGUCACAAAUUCGUAUCUAGGGGAGUAUGUAGUUGAUGUAUAGG
AUTOMATED DESCRIPTION
null
GENE EXPRESSION
All Expression Data: 6 figures from 3 publications
Wild-type Stages, Structures: Gastrula:90%-epiboly (9.0h-10.0h) to Larval:Protruding-mouth (72.0h-96.0h, 3.5mm)
 
MUTATIONS AND SEQUENCE TARGETING REAGENTS
Targeting reagents:
PHENOTYPE No data available
DISEASE ASSOCIATED WITH mir10c HUMAN ORTHOLOG No data available
DISEASE ASSOCIATED WITH mir10c VIA EXPERIMENTAL MODELS No data available
GENE ONTOLOGY No data available
TRANSCRIPTS
Type Name Length (bp) Analysis
miRNA mir10c-001 (1) 22
GENE PRODUCT DESCRIPTION No description available
INTERACTIONS AND PATHWAYS
PLASMIDSNo data available
CONSTRUCTS WITH SEQUENCES FROM mir10c No data available
MARKER RELATIONSHIPS
mir10cContained in: [BAC] CH211-72A16 (order this)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA miRBASE Stem Loop:MI0001888 (1) 95bp
Genomic GenBank:BX927395 (1) 152987bp
Select Tool
OTHER mir10c MIRNA GENE PAGES
  • Alliance (1)
  • ORTHOLOGY for mir10c (Chr: 3)
    CITATIONS (12)