ZFIN ID: ZDB-MIRNAG-070112-1
miRNA Gene Name: microRNA 10c
miRNA Gene Symbol: mir10c    Nomenclature History

{{control.fieldName}} Edit

ID: {{control.nomenID}}
{{control.fieldName}}:
Reason:
Comments:

Attributions

{{pub.zdbID}}
Previous Names: dre-mir-10c, miR-10c (1), miR10c (1), mirn10c (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
miRNA Gene Type: miRNA_gene
Location: Chr: 3 Mapping Details/Browsers
Description: Is expressed in hindbrain; liver; and spinal cord.
Genome Resources: Alliance (1)
Note: Hairpin Sequence from miRBase: CCUGUCAUCUAUAUAUACCCUGUAGAUCCGGAUUUGUGUAAACAGACGCACAGUCACAAAUUCGUAUCUAGGGGAGUAUGUAGUUGAUGUAUAGG
GENE EXPRESSION
All Expression Data: 7 figures from 4 publications
Wild-type Stages, Structures: Gastrula:90%-epiboly (9.0h-10.0h) to Adult (90d-730d, breeding adult)
 
MUTATIONS AND SEQUENCE TARGETING REAGENTS
Sequence Targeting Reagents
Targeting Reagent Created Alleles Publications
MO1-mir10 N/A 2
MO2-mir10 N/A 1
MO3-mir10 N/A 1
MO4-mir10 N/A 1
PHENOTYPE No data available
DISEASE ASSOCIATED WITH mir10c HUMAN ORTHOLOG No data available
DISEASE ASSOCIATED WITH mir10c VIA EXPERIMENTAL MODELS No data available
GENE ONTOLOGY No data available
TRANSCRIPTS
Type Name Length (nt) Analysis
miRNA mir10c-001 (1) 22
INTERACTIONS AND PATHWAYS
ANTIBODIES No data available
PLASMIDS No data available
CONSTRUCTS WITH SEQUENCES FROM mir10c No data available
MARKER RELATIONSHIPS
mir10c Contained in: [BAC] CH211-72A16
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA miRBASE Stem Loop:MI0001888 (1) 95 nt
Genomic GenBank:BX927395 (1) 152987 nt
Select Tool
ORTHOLOGY for mir10c ( Chr: 3 )
CITATIONS (12)