EST Name: ay556398
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 920
Cloning Site: EcoRI
Vector Type: Plasmid
Vector: pBS-IIKS
Polymerase: T7 RNA polymerase
PCR Amplification: 5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Quality: ( Simple to use, intense expression pattern restricted to a few structures )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
Note: Data published in: Bertrand S, Thisse B, Tavares R, Sachs L, Chaumot A, Bardet PL, EscrivĂ  H, Duffraisse M, Marchand O, Safi R, Thisse C, Laudet V. Unexpected Novel Relational Links Uncovered by Extensive Developmental Profiling of Nuclear Receptor Expression. PLoS Genet. 2007 Nov 9;3(11):e188.
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (32 images) from Thisse et al., 2008 [ay556398]
MARKER RELATIONSHIPS
ay556398 Is Encoded by: [Gene] esrrd (2)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AY556398 (1) 1035 nt
Polypeptide GenPept:AAS66637 (1) 344 aa
Select Tool
Genome Resources:
CITATIONS (5)