EST

cssl:d0645

ID
ZDB-EST-080327-63
Name
cssl:d0645
Symbol
cssl:d0645
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
900
Cloning Site
5' NotI 3'AscI
Vector Type
Plasmid
Vector
pTT3
Polymerase
T7 RNA polymerase
PCR Amplification
5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Quality
( Moderate expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (19 images) from Thisse et al., 2008 [cssl:d0645]
Marker Relationships
Sequences
Citations