header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-080327-58
EST Name: cssl:d0634
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1200
Cloning Site: 5' NotI 3'AscI
Vector Type: Plasmid
Vector: pTT3
Polymerase: T7 RNA polymerase
PCR Amplification: 5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Source:
Quality: Rating 4 ( Nice strong expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (17 images) from Thisse et al., 2008 [cssl:d0634]
MARKER RELATIONSHIPS
cssl:d0634 Is Encoded by: [Gene] opcml (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU638768 (1) 2073 bp
Polypeptide GenPept:CAP71917 (1) 342 aa
Select Tool
Genome Resources:
CITATIONS (3)