header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-080327-45
EST Name: cssl:d0146
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 2500
Cloning Site: 5' NotI 3'AscI
Vector Type: Plasmid
Vector: pTT3
Polymerase: T7 RNA polymerase
PCR Amplification: 5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Source:
Quality: Rating 5 ( Simple to use, intense expression pattern restricted to a few structures )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (27 images) from Thisse et al., 2008 [cssl:d0146]
MARKER RELATIONSHIPS
cssl:d0146 Is Encoded by: [Gene] kdrl (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU458916 (1) 5784 bp
Polypeptide GenPept:CAM73177 (1) 1302 aa
Select Tool
Genome Resources:
CITATIONS (3)