header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-080327-33
EST Name: cssl:d0363
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1800
Cloning Site: 5' NotI 3'AscI
Vector Type: Plasmid
Vector: pTT3
Polymerase: T7 RNA polymerase
PCR Amplification: 5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Source:
Quality: Rating 1 ( Probe is difficult to use. Generally basal level of expression with more intense labeling in particular structure. )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2008 [cssl:d0363]
MARKER RELATIONSHIPS
cssl:d0363 Is Encoded by: [Gene] lgi1a (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU468780 (1) 1611 bp
Polypeptide GenPept:CAP08004 (1) 537 aa
Select Tool
Genome Resources:
CITATIONS (3)