EST Name: cssl:d0322
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1300
Cloning Site: 5' NotI 3'AscI
Vector Type: Plasmid
Vector: pTT3
Polymerase: T7 RNA polymerase
PCR Amplification: 5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Quality: Rating 2 ( Weak expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (22 images) from Thisse et al., 2008 [cssl:d0322]
MARKER RELATIONSHIPS
cssl:d0322 Is Encoded by: [Gene] amigo1 (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CU468749 (1) 1104 nt
Genome Resources:
CITATIONS (2)