EST

eu898

ID
ZDB-EST-060130-433
Name
eu898
Symbol
eu898
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
280
Cloning Site
Vector Type
Vector
Polymerase
T3 RNA polymerase
PCR Amplification
Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer TCAGGGTAAAAATCCAGATACC                reverse_primer GGATCCATTAACCCTCACTAAAGGGAACAAAATCAGGACAGGCATTAG
Quality
( Simple to use, intense expression pattern restricted to a few structures )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
6 figures (12 images) from Thisse et al., 2005 [eu898]
Marker Relationships
Sequences
Citations