EST

eu827

ID
ZDB-EST-060130-378
Name
eu827
Symbol
eu827
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
609
Cloning Site
Vector Type
Vector
Polymerase
T3 RNA polymerase
PCR Amplification
Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer CACCTGACGCAGTATTGG                reverse_primer GGATCCATTAACCCTCACTAAAGGGAATTCTAATTGCTGGATGAACC
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
1 figure (1 image) from Thisse et al., 2005 [eu827]
Marker Relationships
Sequences
Citations