EST

eu689

ID
ZDB-EST-060130-270
Name
eu689
Symbol
eu689
Previous Names
None
Type
EST
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
unknown
Digest
Insert Size
404
Cloning Site
Vector Type
Vector
Polymerase
T3 RNA polymerase
PCR Amplification
Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer GTGGTTGAGGACCACTACTC                reverse_primer GGATCCATTAACCCTCACTAAAGGGAAGGGTGAGCTCAGGCATC
Quality
( Nice strong expression pattern )
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
7 figures (33 images) from Thisse et al., 2005 [eu689]
Marker Relationships
Sequences
Citations