EST Name: eu472
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 337
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer CACCATGCCGAAAGAAG                reverse_primer GGATCCATTAACCCTCACTAAAGGGAAGTTTCCATCCCTGGTACAAC
Quality: ( Weak expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (9 images) from Thisse et al., 2005 [eu472]
MARKER RELATIONSHIPS
eu472 Is Encoded by: [Gene] fgf6a (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
Genomic GenBank:DU644498 334 nt
Genome Resources:
CITATIONS (1)