header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-EST-051107-69
EST Name: eu314
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 669
Cloning Site:
Vector Type:
Vector:
Polymerase: T3 RNA polymerase
PCR Amplification: Probes for in situ hybridization amplified by PCR from genomic DNA.
forward_primer CCCTTCAGAAGTTTGACTAACC
reverse_primer GGATCCATTAACCCTCACTAAAGGGAACATTAATGTACTGCAAATTTGTTT
Quality: Rating 2 ( Weak expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (4 images) from Thisse et al., 2005 [eu314]
MARKER RELATIONSHIPS
eu314 Is Encoded by: [Gene] notch2 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
Genomic GenBank:DU644525 306 bp
OTHER eu314 EST PAGES No links to external sites
CITATIONS (1)