ZFIN ID: ZDB-EST-050809-197
EST Name: IMAGE:3818167
Sequence Ontology ID : SO:0000345
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: Sugano Kawakami zebrafish DRA
Digest:
Insert Size: 1900
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Source:
The I.M.A.G.E. Consortium (order this)
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (27 images) from Thisse et al., 2004 [IMAGE:3818167]
MARKER RELATIONSHIPS
IMAGE:3818167 Is Encoded by: [Gene] axin2 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC045281 1629bp
Polypeptide GenPept:AAH45281 (1) 268aa
Select Tool
OTHER IMAGE:3818167 EST PAGESNo links to external sites
CITATIONS (2)