ZFIN ID: ZDB-EREGION-110816-9
Engineered Region Name: FRT
Sequence Ontology ID :
Synonym: Flippase Recognition Target

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Note: Wild type binding site for flippase. The FRT flank the sequence that will be recombined. The FRT sequence is GAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC

{{control.fieldName}} Edit

ID: {{control.nomenID}}
{{control.fieldName}}:
Comments:

Attributions

{{pub.zdbID}}
CONSTRUCTS WITH SEQUENCES FROM FRT
CITATIONS (47)