CRISPR

CRISPR4-tapt1a

ID
ZDB-CRISPR-240813-1
Name
CRISPR4-tapt1a
Previous Names
None
Target
Sequence
5' - GACTCAGTGGCGAGAAGAAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
cmg3 tapt1a
Expression
Gene expression in Wild Types + CRISPR4-tapt1a
No data available
Phenotype
Phenotype resulting from CRISPR4-tapt1a
No data available
Phenotype of all Fish created by or utilizing CRISPR4-tapt1a
Phenotype Fish Conditions Figures
eye melanocyte spatial pattern, abnormal tapt1acmg3/cmg3 (AB) standard conditions Fig. S4 from Jarayseh et al., 2023
eye iridophore spatial pattern, abnormal tapt1acmg3/cmg3 (AB) standard conditions Fig. S4 from Jarayseh et al., 2023
whole organism increased length, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
kidney dorsal side increased pigmentation, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
ciliary marginal zone ventral side decreased size, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
swimming behavior process quality, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 5 from Jarayseh et al., 2023
oral cavity dorsal side increased pigmentation, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
swim bladder dorsal side increased pigmentation, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
retina increased thickness, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
anterior chamber eye collapsed, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
retinal inner plexiform layer inclusion body present, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
retinal ganglion cell layer hyperplastic, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
pupil decreased area, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 3 from Jarayseh et al., 2023
dorsal aorta dorsal side increased pigmentation, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
retinal ganglion cell layer increased thickness, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
eye melanocyte spatial pattern, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
ciliary marginal zone dorsal side decreased size, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
lens capsule delaminated, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
photoreceptor outer segment layer degenerate, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
retinal inner plexiform layer increased thickness, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
lens decreased size, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
whole organism opn1mw2 expression increased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
whole organism mipa expression decreased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
whole organism timp2b expression increased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
retinal inner plexiform layer hyperplastic, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
integument increased pigmentation, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
whole organism cryaa expression decreased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
whole organism dead, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. S2 from Jarayseh et al., 2023
lens cell mislocalised, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
whole organism crygn1 expression decreased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
eye iridophore spatial pattern, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 2 from Jarayseh et al., 2023
anterior chamber eye opacity, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
vitreous absence of anatomical entity, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
retinal pigmented epithelium low brightness, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
eye decreased area, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 3 from Jarayseh et al., 2023
lens position, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 4 from Jarayseh et al., 2023
pupil decreased ratio eye, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 3 from Jarayseh et al., 2023
optokinetic behavior decreased process quality, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 5 from Jarayseh et al., 2023
whole organism col2a1a expression increased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
whole organism rom1a expression decreased amount, abnormal tapt1acmg3/cmg3; tapt1bcmg6/cmg6 (AB) standard conditions Fig. 7 from Jarayseh et al., 2023
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.