CRISPR

CRISPR1-tmem38b

ID

ZDB-CRISPR-240329-11

Name

CRISPR1-tmem38b

Previous Names

None

Target

tmem38b (1)

Sequence

5' - GGTTCTCGTCACTTCCTTCATGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
upv4	tmem38b
upv5	tmem38b

Expression

Gene expression in Wild Types + CRISPR1-tmem38b

No data available

Phenotype

Phenotype resulting from CRISPR1-tmem38b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-tmem38b

Phenotype	Fish	Conditions	Figures
vertebra decreased length, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 3 from Tonelli et al., 2023
caudal fin mpeg1.1 expression increased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
caudal fin sp7 expression increased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 5 from Tonelli et al., 2023
caudal fin actinotrichium decreased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
notochordal ossification bone mineralization decreased process quality, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 3 from Tonelli et al., 2023
vertebra decreased height, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 3 from Tonelli et al., 2023
caudal fin principal ray bone mineralization increased process quality, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 5 from Tonelli et al., 2023
caudal fin ctsk expression increased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
skeletal tissue collagen metabolic process decreased process quality, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
caudal fin actinotrichium decreased length, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
whole organism decreased length, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 3 from Tonelli et al., 2023
caudal fin tnfrsf11b expression increased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
caudal fin bglap expression decreased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 5 from Tonelli et al., 2023
brain tmem38b expression decreased amount, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 2 from Tonelli et al., 2023
integument collagen metabolic process decreased process quality, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
caudal fin acp5a expression increased amount, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
caudal fin principal ray increased length, abnormal	tmem38b^upv4/upv4 (AB)	amputation: caudal fin	Figure 5 from Tonelli et al., 2023
osteoblast endoplasmic reticulum cisternal network increased size, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
caudal fin principal ray bone mineralization decreased process quality, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 5 from Tonelli et al., 2023
caudal fin bglap expression increased amount, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 5 from Tonelli et al., 2023
fibroblast collagen biosynthetic process process quality, ameliorated	tmem38b^upv4/upv4 (AB)	chemical treatment by environment: 4-phenylbutyrate	Figure 4 from Tonelli et al., 2023
fibroblast endoplasmic reticulum cisternal network increased size, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
fibroblast collagen biosynthetic process increased process quality, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
swim bladder swim bladder inflation decreased process quality, abnormal	tmem38b^upv4/upv4 (AB)	standard conditions	Figure 3 from Tonelli et al., 2023
caudal fin mpeg1.1 expression increased amount, abnormal	tmem38b^upv5/upv5 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
fibroblast collagen biosynthetic process process quality, ameliorated	tmem38b^upv5/upv5 (AB)	chemical treatment by environment: 4-phenylbutyrate	Figure 4 from Tonelli et al., 2023
caudal fin actinotrichium decreased length, abnormal	tmem38b^upv5/upv5 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
caudal fin tnfrsf11b expression increased amount, abnormal	tmem38b^upv5/upv5 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
caudal fin ctsk expression increased amount, abnormal	tmem38b^upv5/upv5 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
caudal fin acp5a expression increased amount, abnormal	tmem38b^upv5/upv5 (AB)	amputation: caudal fin	Figure 6 from Tonelli et al., 2023
fibroblast collagen biosynthetic process increased process quality, abnormal	tmem38b^upv5/upv5 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
fibroblast endoplasmic reticulum cisternal network increased size, abnormal	tmem38b^upv5/upv5 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023
osteoblast endoplasmic reticulum cisternal network increased size, abnormal	tmem38b^upv5/upv5 (AB)	standard conditions	Figure 4 from Tonelli et al., 2023

Citations