CRISPR

CRISPR1-rab25b

ID

ZDB-CRISPR-220309-4

Name

CRISPR1-rab25b

Previous Names

None

Target

rab25b (1)

Sequence

5' - GTGCGCTCCGTTCCTACAGAGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
uot11	rab25b

Expression

Gene expression in Wild Types + CRISPR1-rab25b

No data available

Phenotype

Phenotype resulting from CRISPR1-rab25b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-rab25b

Phenotype	Fish	Conditions	Figures
EVL recycling endosome increased diameter, abnormal	rab25b^uot11/uot11	control	Figure 7—figure supplement 2. from Willoughby et al., 2021
EVL cytokinesis disrupted, abnormal	rab25b^uot11/uot11	control	Figure 3. , Figure 4 from Willoughby et al., 2021
epiboly delayed, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 , Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL apical part of cell increased size, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 from Willoughby et al., 2021
EVL intercellular bridge increased length, abnormal	rab25b^uot11/uot11	control	Figure 3. from Willoughby et al., 2021
EVL contractile ring contraction disrupted, abnormal	rab25b^uot11/uot11	standard conditions	Figure 4 , Figure 4—figure supplement 1. from Willoughby et al., 2021
EVL abscission delayed, abnormal	rab25b^uot11/uot11	control	Figure 3. from Willoughby et al., 2021
forerunner cell group disorganized, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
DEL epiboly delayed, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cell decreased size, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 from Willoughby et al., 2021
EVL cell disorganized, abnormal	rab25b^uot11/uot11	control	Figure 5 from Willoughby et al., 2021
EVL cell morphology, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 , Figure 2—figure supplement 2. from Willoughby et al., 2021
EVL cell increased size, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 from Willoughby et al., 2021
EVL spindle disoriented, abnormal	rab25b^uot11/uot11	control	Figure 4—figure supplement 1. from Willoughby et al., 2021
EVL endocytic recycling decreased process quality, abnormal	rab25b^uot11/uot11	control	Figure 7 from Willoughby et al., 2021
EVL apical part of cell decreased size, abnormal	rab25b^uot11/uot11	control	Figure 2 , Figure 4 from Willoughby et al., 2021
EVL epiboly delayed, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cell-cell junction ab1-myl-ser19-p labeling decreased amount, abnormal	rab25b^uot11/uot11	standard conditions	Figure 6 from Willoughby et al., 2021
EVL intercellular bridge organization increased duration, abnormal	rab25b^uot11/uot11	control	Figure 3. from Willoughby et al., 2021
EVL intercellular bridge decreased stability, abnormal	rab25b^uot11/uot11	control	Figure 3. from Willoughby et al., 2021
EVL cortical actin cytoskeleton decreased amount, abnormal	rab25b^uot11/uot11	standard conditions	Figure 6 , Figure 6—figure supplement 1. from Willoughby et al., 2021
yolk cytoskeleton disorganized, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 from Willoughby et al., 2021
blastomere morphology, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021
EVL cell mosaicism, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 from Willoughby et al., 2021
EVL cell decreased amount, abnormal	rab25b^uot11/uot11	standard conditions	Figure 2 from Willoughby et al., 2021
epiboly process quality, ameliorated	rab25b^uot11/uot11; uot16Tg	standard conditions	Figure 2—figure supplement 1. from Willoughby et al., 2021

Citations