ZFIN ID: ZDB-CRISPR-200324-6
CRISPR Name: CRISPR1-ppp2cab
Target: ppp2cab (1)
Source:
Target Sequence:
5' - GACGAAGGAGTCGAATGTGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-ppp2cab No data available
GENOMIC FEATURES CREATED WITH CRISPR1-ppp2cab No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-ppp2cab No data available
PHENOTYPE
Phenotype resulting from CRISPR1-ppp2cab
No data available

Phenotype of all Fish created by or utilizing CRISPR1-ppp2cab
No data available
Genome Resources:
CITATIONS (1)