CRISPR

CRISPR2-epha4a

ID

ZDB-CRISPR-200313-3

Name

CRISPR2-epha4a

Previous Names

None

Target

epha4a (1)

Sequence

5' - GGCTGATGAAAGCTTCACGC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
fci5	epha4a

Expression

Gene expression in Wild Types + CRISPR2-epha4a

No data available

Phenotype

Phenotype resulting from CRISPR2-epha4a

No data available

Phenotype of all Fish created by or utilizing CRISPR2-epha4a

Phenotype	Fish	Conditions	Figures
rhombomere 3 egr2b expression spatial pattern, abnormal	epha4a^fci5/fci5	standard conditions	Figure 2 from Cayuso et al., 2019
rhombomere 5 posterior margin wwtr1 expression decreased distribution, abnormal	epha4a^fci5/fci5	standard conditions	Figure 6 from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression decreased distribution, abnormal	epha4a^fci5/fci5	standard conditions	Figure 2 , Figure 4. from Cayuso et al., 2019
rhombomere 2 posterior margin wwtr1 expression amount, ameliorated	epha4a^fci5/fci5	standard conditions	Figure 6 from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression decreased distribution, abnormal	epha4a^fci5/fci5	standard conditions	Figure 2 , Figure 4. from Cayuso et al., 2019
rhombomere 5 egr2b expression spatial pattern, abnormal	epha4a^fci5/fci5	standard conditions	Figure 2 from Cayuso et al., 2019
rhombomere 6 posterior margin wwtr1 expression amount, ameliorated	epha4a^fci5/fci5	standard conditions	Figure 6 from Cayuso et al., 2019
rhombomere 1 posterior margin wwtr1 expression amount, ameliorated	epha4a^fci5/fci5	standard conditions	Figure 6 from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression decreased distribution, abnormal	epha4a^fci5/fci5	standard conditions	Figure 2 , Figure 4. from Cayuso et al., 2019
rhombomere 4 posterior margin wwtr1 expression amount, ameliorated	epha4a^fci5/fci5	standard conditions	Figure 6 from Cayuso et al., 2019
rhombomere 3 posterior margin wwtr1 expression decreased distribution, abnormal	epha4a^fci5/fci5	standard conditions	Figure 6 from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression amount, ameliorated	epha4a^fci5/fci5 + MO2-ppp1r12a	standard conditions	Figure 4. from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression amount, ameliorated	epha4a^fci5/fci5 + MO2-ppp1r12a	standard conditions	Figure 4. from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression amount, ameliorated	epha4a^fci5/fci5 + MO2-ppp1r12a	standard conditions	Figure 4. from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression amount, ameliorated	epha4a^fci5/fci5 + MO2-ppp1r12a	standard conditions	Figure 4. from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression amount, ameliorated	epha4a^fci5/fci5 + MO2-ppp1r12a	standard conditions	Figure 4. from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression decreased distribution, abnormal	epha4a^fci5/fci5 + MO2-ppp1r12a	standard conditions	Figure 4. from Cayuso et al., 2019

Citations