ZFIN ID: ZDB-CRISPR-200114-2
CRISPR Name: CRISPR8-junbb
Target: junbb (1)
Source:
Target Sequence:
5' - GAGGCTCCGATAGGGCGGCT - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR8-junbb No data available
GENOMIC FEATURES CREATED WITH CRISPR8-junbb
Genomic Feature Affected Genomic Regions    
ihb381 junbb    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR8-junbb No data available
PHENOTYPE
Phenotype resulting from CRISPR8-junbb
No data available

Phenotype of all Fish created by or utilizing CRISPR8-junbb
No data available
Genome Resources:
CITATIONS (1)