ZFIN ID: ZDB-CRISPR-180626-2
CRISPR Name: CRISPR1-epor
Target: epor (1)
Source:
Target Sequence:
5' - AGTTAATCCGAGATGAAACC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-epor No data available
GENOMIC FEATURES CREATED WITH CRISPR1-eporNo data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-epor No data available
PHENOTYPE
Phenotype resulting from CRISPR1-epor
Phenotype Figures
nucleate erythrocyte decreased amount, abnormal Fig. 4 with image from She et al., 2017
pronephric glomerulus increased size, abnormal Fig. 4 with imageFig. S7 with image from She et al., 2017
pronephric glomerulus apoptotic process increased occurrence, abnormal Fig. 5 with imageFig. S7 with image from She et al., 2017
pronephric tubule decreased length, abnormal Fig. 4 with imageFig. S7 with image from She et al., 2017
pronephros decreased functionality, abnormal Fig. 4 with image from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal Fig. 5 with image from She et al., 2017

Phenotype of all Fish created by or utilizing CRISPR1-epor
Phenotype Fish Conditions Figures
pronephric tubule decreased length, abnormal li1Tg + CRISPR1-epor control Fig. 4 with imageFig. S7 with image from She et al., 2017
pronephros decreased functionality, abnormal li1Tg + CRISPR1-epor control Fig. 4 with image from She et al., 2017
pronephric glomerulus increased size, abnormal li1Tg + CRISPR1-epor control Fig. 4 with imageFig. S7 with image from She et al., 2017
pronephric glomerulus apoptotic process increased occurrence, abnormal li1Tg + CRISPR1-epor control Fig. 5 with imageFig. S7 with image from She et al., 2017
nucleate erythrocyte decreased amount, abnormal li1Tg + CRISPR1-epor control Fig. 4 with image from She et al., 2017
pronephros apoptotic process increased occurrence, abnormal li1Tg + CRISPR1-epor control Fig. 5 with image from She et al., 2017
OTHER CRISPR1-epor CRISPR PAGESNo links to external sites
CITATIONS (1)