ZFIN ID: ZDB-CRISPR-180213-410
CRISPR Name: CRISPR1-unm_zko1085b
Target: unm_zko1085b (1)
Source:
Target Sequence:
5' - GGTTTGAGGTGGGCGTCCGG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-unm_zko1085b No data available
GENOMIC FEATURES CREATED WITH CRISPR1-unm_zko1085b
Genomic Feature Affected Genomic Regions    
zko1085b unm_zko1085b    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-unm_zko1085b No data available
PHENOTYPE
Phenotype resulting from CRISPR1-unm_zko1085b
No data available

Phenotype of all Fish created by or utilizing CRISPR1-unm_zko1085b
No data available
Genome Resources:
CITATIONS (1)