header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-171010-6
CRISPR Name: CRISPR1-fsta
Target: fsta (1)
Source:
Target Sequence:
5' - GGTGGATGATCTTCAATGGC - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATIONS
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-fsta No data available
GENOMIC FEATURES CREATED WITH CRISPR1-fsta
Genomic Feature Affected Genomic Regions    
el624 fsta    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-fsta No data available
PHENOTYPE
Phenotype resulting from CRISPR1-fsta
No data available

Phenotype of all Fish created by or utilizing CRISPR1-fsta
Phenotype Fish Conditions Figures
symplectic decreased length, abnormal fstael624/el624 standard conditions Fig. 6 with imageFig. S3 with image from Askary et al., 2017
ceratohyal cartilage fused with interhyal cartilage, abnormal fstael624/el624 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal fstael624/el624 standard conditions Fig. S3 with image from Askary et al., 2017
interhyal-hyosymplectic joint absent, abnormal fstael624/el624 standard conditions Fig. 6 with image from Askary et al., 2017
hyosymplectic cartilage fused with interhyal cartilage, abnormal fstael624/el624 standard conditions Fig. 6 with imageFig. S3 with image from Askary et al., 2017
ceratohyal-interhyal joint absent, abnormal fstael624/el624 standard conditions Fig. 6 with image from Askary et al., 2017
symplectic decreased length, abnormal fstael624/el624 ; emx2el586/el586 standard conditions Fig. 6 with image from Askary et al., 2017
ceratohyal cartilage fused with interhyal cartilage, abnormal fstael624/el624 ; emx2el586/el586 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, abnormal fstael624/el624 ; emx2el586/el586 standard conditions Fig. 6 with image from Askary et al., 2017
hyosymplectic cartilage has extra parts of type joint, abnormal fstael624/el624 ; emx2el586/el586 standard conditions Fig. 6 with image from Askary et al., 2017
symplectic articulated with hyomandibula, abnormal fstael624/el624 ; emx2el586/el586 standard conditions Fig. 6 with image from Askary et al., 2017
opercle decreased size, abnormal fstael624/el624 ; emx2el586/el586 standard conditions Fig. 6 with image from Askary et al., 2017
interhyal-hyosymplectic joint malformed, exacerbated fstael624/el624 ; fstbel675/el675 standard conditions Fig. S3 with image from Askary et al., 2017
symplectic decreased length, exacerbated fstael624/el624 ; fstbel675/el675 standard conditions Fig. S3 with image from Askary et al., 2017
hyosymplectic cartilage fused with interhyal cartilage, exacerbated fstael624/el624 ; fstbel675/el675 standard conditions Fig. S3 with image from Askary et al., 2017
interhyal-hyosymplectic joint irx7 expression decreased amount, abnormal fstael624/el624 ; fstbel675/el675 standard conditions Fig. 6 with image from Askary et al., 2017
OTHER CRISPR1-fsta CRISPR PAGESNo links to external sites
CITATIONS (1)