header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CRISPR-170920-1
CRISPR Name: CRISPR1-twist3
Target: twist3 (1)
Source:
Target Sequence:
5' - AGGACTGATCGTCATGCGAG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-twist3 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-twist3No data available
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-twist3 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-twist3
No data available

Phenotype of all Fish created by or utilizing CRISPR1-twist3
OTHER CRISPR1-twist3 CRISPR PAGESNo links to external sites
CITATIONS (1)