ZFIN ID: ZDB-CRISPR-170801-3
CRISPR Name: CRISPR1-npc1
Target: npc1 (1)
Source:
Target Sequence:
5' - CCATCAGAGTTTAAGGAGTG - 3'
   
Select Sequence Analysis Tool

  (Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.)
TARGET LOCATION
No data available
CONSTRUCTS WITH SEQUENCES FROM CRISPR1-npc1 No data available
GENOMIC FEATURES CREATED WITH CRISPR1-npc1
Genomic Feature Affected Genomic Regions    
hg37 npc1    
GENE EXPRESSION
Gene expression in Wild Types + CRISPR1-npc1 No data available
PHENOTYPE
Phenotype resulting from CRISPR1-npc1
No data available

Phenotype of all Fish created by or utilizing CRISPR1-npc1
Phenotype Fish Conditions Figures
whole organism decreased life span, abnormal npc1hg37/hg37 standard conditions text only from Tseng et al., 2018
whole organism decreased size, abnormal npc1hg37/hg37 standard conditions Fig. 2 with image from Tseng et al., 2018
liver opaque, abnormal npc1hg37/hg37 chemical treatment by environment: beta-cyclodextrin Fig. S2 with image from Tseng et al., 2018
liver npc1 expression absent, abnormal npc1hg37/hg37 standard conditions Fig. 4 with imageFig. S1 from Tseng et al., 2018
peripheral olfactory organ lysosome increased amount, abnormal npc1hg37/hg37 control Fig. 8 with image from Tseng et al., 2018
neuromast cholesterol increased amount, abnormal npc1hg37/hg37 control Fig. 8 with image from Tseng et al., 2018
peripheral olfactory organ lysosome amount, ameliorated npc1hg37/hg37 chemical treatment by environment: beta-cyclodextrin Fig. 8 with image from Tseng et al., 2018
liver low brightness, abnormal npc1hg37/hg37 chemical treatment by environment: beta-cyclodextrin Fig. S2 with image from Tseng et al., 2018
hepatocyte structure, abnormal npc1hg37/hg37 standard conditions Fig. 3 with image from Tseng et al., 2018
liver cholesterol increased amount, abnormal npc1hg37/hg37 standard conditions Fig. 4 with image from Tseng et al., 2018
liver opaque, abnormal npc1hg37/hg37 control Fig. 4 with imageFig. S2 with image from Tseng et al., 2018
neuromast cholesterol amount, ameliorated npc1hg37/hg37 chemical treatment by environment: beta-cyclodextrin Fig. 8 with image from Tseng et al., 2018
whole organism semi-viable, abnormal npc1hg37/hg37 standard conditions text only from Tseng et al., 2018
neuromast lysosome increased amount, abnormal npc1hg37/hg37 control Fig. 7 with imageFig. 8 with image from Tseng et al., 2018
whole organism sterile, abnormal npc1hg37/hg37 standard conditions text only from Tseng et al., 2018
liver low brightness, abnormal npc1hg37/hg37 control Fig. 4 with imageFig. S2 with image from Tseng et al., 2018
Purkinje cell disorganized, abnormal npc1hg37/hg37 standard conditions Fig. 3 with image from Tseng et al., 2018
trunk cholesterol increased amount, abnormal npc1hg37/hg37 standard conditions Fig. 5 with image from Tseng et al., 2018
yolk syncytial layer cholesterol increased amount, abnormal npc1hg37/hg37 control Fig. 6 with image from Tseng et al., 2018
hindbrain axon structure, abnormal npc1hg37/hg37 standard conditions Fig. 3 with image from Tseng et al., 2018
extension cholesterol increased amount, abnormal npc1hg37/hg37 standard conditions Fig. 5 with image from Tseng et al., 2018
OTHER CRISPR1-npc1 CRISPR PAGESNo links to external sites
CITATIONS (2)