CRISPR

CRISPR2-tia1l

ID
ZDB-CRISPR-140710-3
Name
CRISPR2-tia1l
Previous Names
  • tia1l_GGN18 (1)
Target
Sequence
5' - GGTCTCCAGGGATGTTACGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This CRISPR contains a 2 nt mismatch at the 5' end.
Genome Resources
None
Target Location
View all 9 target locations
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR2-tia1l
No data available
Phenotype
Phenotype resulting from CRISPR2-tia1l
No data available
Phenotype of all Fish created by or utilizing CRISPR2-tia1l
No data available
Citations