ZFIN ID: ZDB-CDNA-080114-10
cDNA Name: cssl:d114
Sequence Ontology ID : SO:0000756
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: unknown
Digest:
Insert Size: 1900
Cloning Site: 5' NotI 3'AscI
Vector Type: Plasmid
Vector: pTT3
Polymerase: T7 RNA polymerase
PCR Amplification: 5'ACAGGTGTCCACTCCCAGGTCCAAG 3'
5'GGATCCTAATACGACTCACTATAGGGAGGCCGTGATGGAGGTCGACGGCG3'
Source:
Wright Lab (order this)
Quality: Rating 4 ( Nice strong expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (33 images) from Thisse et al., 2008 [cssl:d114]
MARKER RELATIONSHIPS
cssl:d114 Is Encoded by: [Gene] kita (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:CU458898 (1) 2942bp
OTHER cssl:d114 cDNA PAGESNo links to external sites
CITATIONS (2)