cDNA

MGC:112199

ID
ZDB-CDNA-050417-206
Name
MGC:112199
Symbol
MGC:112199
Previous Names
  • FR_9503 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_19
Digest
Insert Size
906
Cloning Site
EcoRI-PstI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T3 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
1 figure (1 image) from Thisse et al., 2004 [MGC:112199]
Marker Relationships
Sequences
Citations