cDNA Name: MGC:110821
Sequence Ontology ID : SO:0000756
Previous Name: FR_9610 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: GISZF001_ra
Digest:
Insert Size: 1010
Cloning Site: Sfi A - Sfi B
Vector Type: plasmid
Vector: pDNR-LIB
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGGATAACCGTATTACCGCC 3'
5' CGCGCAATTAACCCTCACTAAAGCACTAGTCATACCAGGATC 3'
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2004 [MGC:110821]
MARKER RELATIONSHIPS
MGC:110821 Is Encoded by: [Gene] zgc:110821 (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC090307 (1) 1010 nt
Polypeptide GenPept:AAH90307 (1) 279 aa
Select Tool
Genome Resources:
CITATIONS (3)