cDNA Name: MGC:92590
Sequence Ontology ID : SO:0000756
Previous Name: FR_7760 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: Sugano SJD adult male
Digest:
Insert Size: 1000
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Quality: ( Weak expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Chr: 16 Details
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 7 figures (3 images) from Thisse et al., 2004 [MGC:92590]
MARKER RELATIONSHIPS
MGC:92590 Is Encoded by: [Gene] zgc:92590 (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC083528 (1) 876 nt
Genome Resources:
CITATIONS (3)