cDNA

MGC:92657

ID
ZDB-CDNA-040801-186
Name
MGC:92657
Symbol
MGC:92657
Previous Names
  • FR_7317 (1)
Type
cDNA
Location
Unmapped
Genome Resources
None
Species
Danio rerio
Library
NIH_ZGC_9
Digest
Insert Size
930
Cloning Site
EcoRI-PstI
Vector Type
Plasmid
Vector
pME18S-FL3
Polymerase
T3 RNA polymerase
PCR Amplification
Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Protocol
Thisse in situ hybridization protocol
Note
None
Gene Expression
Directly Submitted Expression Data
1 figure (1 image) from Thisse et al., 2004 [MGC:92657]
Marker Relationships
Sequences
Citations