ZFIN ID: ZDB-CDNA-040801-137
cDNA Name: MGC:100991
Sequence Ontology ID : SO:0000756
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: GISZF001_ra
Digest:
Insert Size: 320
Cloning Site: EcoRI
Vector Type: plasmid
Vector: pDNR-LIB
Polymerase: T7 RNA polymerase
PCR Amplification: 5' AACAGCTATGACCATGATTAC 3'
5' GTA AAA CGA CGG CCA GT 3'
Source:
Zebrafish Gene Collection (ZGC) (order this)
Quality: Rating 5 ( Simple to use, intense expression pattern restricted to a few structures )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (31 images) from Thisse et al., 2008 [MGC:100991]
MARKER RELATIONSHIPS
MGC:100991 Is Encoded by: [Gene] nr2e1 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC077146 (1) 2730bp
OTHER MGC:100991 cDNA PAGESNo links to external sites
CITATIONS (4)