header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-CDNA-040502-1
cDNA Name: MGC:76883
Sequence Ontology ID : SO:0000756
Previous Name: FR_6895 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZEmb2
Digest:
Insert Size: 1511
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTAAAACGACGGCCAGT 3'
Source:
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2004 [MGC:76883]
MARKER RELATIONSHIPS
MGC:76883 Is Encoded by: [Gene] dusp19b (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC069175 (1) 1511 bp
Polypeptide GenPept:AAH69175 (1) 205 aa
Select Tool
Genome Resources:
CITATIONS (3)