cDNA Name: MGC:55208
Sequence Ontology ID : SO:0000756
Previous Name: FR4621 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: Sugano Kawakami zebrafish DRA
Digest:
Insert Size: 2131
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 5 figures (13 images) from Thisse et al., 2004 [MGC:55208]
MARKER RELATIONSHIPS
MGC:55208 Is Encoded by: [Gene] mef2aa (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC044337 (1) 2131 nt
Genome Resources:
CITATIONS (3)