ZFIN ID: ZDB-CDNA-040425-3751
cDNA Name: MGC:63781
Sequence Ontology ID : SO:0000756
Previous Name: FR5192 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: Sugano Kawakami zebrafish DRA
Digest:
Insert Size: 4115
Cloning Site: EcoRI-PstI
Vector Type: Plasmid
Vector: pME18S-FL3
Polymerase: T3 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' TGTACGGAAGTGTTACTTCTGCTC3'
5'GGATCCATTAACCCTCACTAAAGGGAAGGCCGCGACCTGCAGCTC3'
Source:
Zebrafish Gene Collection (ZGC) (order this)
Protocol: Thisse in situ hybridization protocol
Location: Chr: 3 Details
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 1 figure (1 image) from Thisse et al., 2004 [MGC:63781]
MARKER RELATIONSHIPS
MGC:63781 Is Encoded by: [Gene] atp13a1 (1)
SEQUENCE INFORMATION
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC055391 (1) 4115bp
OTHER MGC:63781 cDNA PAGESNo links to external sites
CITATIONS (3)