cDNA Name: MGC:85807
Sequence Ontology ID : SO:0000756
Previous Name: FR_6996 (1)

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Species: Danio rerio
Library: NCI_CGAP_ZKid1
Digest:
Insert Size: 2542
Cloning Site: NotI-SmaI
Vector Type: phagemid
Vector: pCMV-SPORT6.1
Polymerase: T7 RNA polymerase
PCR Amplification: Reaction denatured 4 min. followed by PCR cycling 95°C 30s, 55°C 30s, 72°C 3 min. (at least 1 min. per kb) followed by elongation at 72°C 7 min.
5' AACAGCTATGACCATGATTAC 3'
5' GTAAAACGACGGCCAGT 3'
Quality: Rating 3 ( Moderate expression pattern )
Protocol: Thisse in situ hybridization protocol
Location: Unmapped
GBROWSE
GENE EXPRESSION
Directly Submitted Expression Data: 6 figures (8 images) from Thisse et al., 2004 [MGC:85807]
MARKER RELATIONSHIPS
MGC:85807 Is Encoded by: [Gene] stxbp2 (1)
SEQUENCE INFORMATION
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC068392 (1) 2542 nt
Genome Resources:
CITATIONS (3)